This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCTACACGACAATTTATAAA, GCAATTTTGCTTTTGCCCAA, GTTGCTGGAGCCTACAGTGA and TTCATGTTAGGGGACGAGCG, which resulted in a 392 bp deletion beginning at Chromosome 8 position 31,166,493 bp and ending after 31,166,884 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000210909 and ENSMUSE00000210910 (exons 2 and 3) and 232 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 5 and early truncation 6 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count