Samd11^em1(IMPC)J

This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCTGCAGTGGACCTTGAACG, TAGAGCTGCCCCGAGAGCAG, CCTACGGGAGCTTATCAGGG and CATCTTGGTGAGCAGGGCAT, which resulted in a 519 bp deletion beginning at Chromosome 4 position 156,250,058 bp and ending after 156,250,576 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001049485 (exon 5) and 356 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 106 and early truncation 19 amino acids later. (J:188991)