This allele was generated at The Jackson Laboratory by electroporation of Cas9 protein and 4 guide sequences CTAACAGAGCTTCTCAAACT, TTTGCTCTTACCACCACCAA, GTTCACTCGCCAGGGAGGCA and ACGTTTTGTAGAATTAATGA, which resulted in a 396 bp deletion beginning at Chromosome 8 position 126,940,940 bp and ending after 126,941,335 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000480474 (exon 2) and 349 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 40 and early truncation 2 amino acids later. (J:188991)