Atp9b^em1(IMPC)J

This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TCATCAGAAGGCAAACGCTG, GTATGGAAATAGTAAAGAAC, ATTGCTAACTATGTAGACTT and CATTGATTGTCTATATTCCT, which resulted in a 748 bp deletion beginning at Chromosome 18 position 80,912,310 bp and ending after 80,913,057 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000304562 (exon 3) and 597 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 96 and early truncation 10 amino acids later. (J:188991)