Cas9 and guide sequences GTACATCTCTGTCGGCTATG targeting H2-D1b and ATAATCCGAGATTTGAGCCG targeting H2-K1d were injected into NOD/ShiLtDvs embryos resulting in two deletions in exon 2, one 11 bp and one 3 bp, in addition to the single nucleotide deletion that is H2-K1em1Dvs. (J:257229)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count