This single nucleotide (G) deletion within exon 2 was shown by flow cytometry to cause a null allele. it was generated by injection of Cas9 and guide sequences GTACATCTCTGTCGGCTATG targeting H2-D1b and ATAATCCGAGATTTGAGCCG targeting H2-K1d into NOD/ShiLtDvs embryos, which resulted in this point deletion and the intragenic deletions of H2-D1em5Dvs. (J:257229)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count