Exon 22 was targeted using an sgRNA (targeting AGAGACAGCCATTCATTCCAAGG) using CRISPR/Cas9 technology resulting in a 5 bp deletion (GRCm39:chr15:102022204_102022208delTTCCA) in the M3 founder line, creating a frame-shift and premature stop codon (p.F1168Rfs*48). Both the C-terminal Src homology (SH2) and phosphotyrosine binding (PTB) domains in the encoded peptide are affected. (J:244469)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count