This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCATTTAGTGGCAGAGGGAA, CCTTTCTTATTCTGTCAGCG, ATGTACACGGGAAAAGACCA and ACACGGGAAAAGACCATGGC, which resulted in a 775 bp deletion beginning at Chromosome 4 positive strand position 42,956,466 bp and ending after 42,957,240 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001313254 (exon 3) and 173 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 71 and early truncation 11 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count