Fyco1^em1(IMPC)J

This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACAAAACCAGTGCATGACAG, GTGCTTTCCGAACCACACCC, GGACATTCAACTATTCAGGT and TAAGATGCGTGTCAATTCTA, which resulted in a 376 bp deletion beginning at Chromosome 9 negative strand position 123,840,459 bp and ending after 123,840,834 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000149201 (exon 4) and 269 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 18 and early truncation 1 amino acid later. (J:188991)