This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCAAGCTGGTAAATAAGCAG, TATAAGCTGTTCTTATTCCA, TGCCTCAAAAGGATTTCAAA and GCGAATATTACAAATGTTGA, which resulted in a 442 bp deletion beginning at Chromosome X negative strand position 60,295,494 bp and ending after 60,295,053 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001283081 (exon 7) and 338 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 185 and early truncation 8 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count