Myom2^em1(IMPC)J

This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACCAGTTGTCCTATGACCAA, CATGAGAGACTGAAATACTT, TCTAATGCTTCACTAACCGT and CCTTTTCTACACCCCGAGGG, which resulted in a 508 bp deletion beginning at Chromosome 8 negative strand position 15,069,595 bp and ending after 15,069,088 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001260151 (exon 4) and 369 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 88 and early truncation 15 amino acids later. (J:188991)