Slc36a2^em1(IMPC)J

This allele from project was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTGTAGCAGTCAGTGCTTGG, GTAAAGGTAGACTGGGTAAC, CAGCACTTCAATTACCTGCG and AGGATACAGGAAAATCGAGA, which resulted in a 479 bp deletion beginning at Chromosome 11 negative strand position 55,181,761 bp and ending after 55,181,283 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001295210 (exon 2) and 388 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 50 and early truncation 7 amino acids later. (J:188991)