Srek1^em1(IMPC)J

This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CGTCCTGTACAACAACACTG, GTGTTTCTGCGAGGCTAGAA, AGTAGTGCTCTATTTAGTTG and AGATCAGTCATCACTTTCTA, which resulted in a 384 bp deletion beginning at Chromosome 13 negative strand position 103,759,538 bp and ending after 103,759,155 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000314888 (exon 4) and 253 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 139 and early truncation 4 amino acids later. (J:188991)