This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCTTGTCTCTTCTTCTCCAA, CCCCAAAGTGTGCAAACAGG, GGAAAGTCAAGAGCTCAGAA and GGAGGGACATTAGAGTATGC, which resulted in a 404 bp deletion beginning at Chromosome 11 positive strand position 106,799,857 bp and ending after 106,800,260 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000108594 (exon 5) and 304 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 123 and early truncation 22 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count