This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTCACTCTCTAACAGATTGT, CTGTAAAATAAAACTTAGCG, CAGATATTCTAGCCACAGAT and GTTGTATTTACGGTGTTTCT, which resulted in a 736 bp deletion beginning at Chromosome 2 positive strand position 162,933,223 bp and ending after 162,933,958 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001226087 and ENSMUSE00001223759 (exons 3 and 4) and 402 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 85 and early truncation 92 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count