This allele from project Svop1-111592J-4927M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GAGCTTGCAGCTACTCCACG, AATTCAAGACTCCATCTTAG, ATACCTGTAGAGGTGGGCCA and GGCAGAGTATGAGAACCACT, which resulted in a 376 bp deletion beginning at Chromosome 6 negative strand position 38,041,189 bp and ending after 38,040,814 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001309504 (exon 3) and 284 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 27 and early truncation 19 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count