CRISPR/Cas9 technology inserted an Il2ra intron 1 enhancer region guide RNA and Cas9 mRNA. The gRNA carries a C to T mutation associated with human inflammatory bowel disease (GAAGGAGGTATCTATTTTGGTCCC to GAAGGAGGTATTTATTTTGGTCCC) and Type 1 Diabetes (T1D). Expression of the Il2ra gene is not blocked, but in vitro gene activation in response to cell stimulation with anti-CD3/CD28 antibodies is delayed. (J:253576)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count