Ppfia3^em1(IMPC)J

This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTGCCACAGACAGAAAGGGC, GGAGCTTGCCACAGACAGAA, GATGAGGGATGGGTTAAGGA and GTTGAGTGAGACATGAAGGG, which resulted in a 824 bp deletion beginning at Chromosome 7 negative strand position 45,355,486 bp and ending after 45,354,663 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001273174, ENSMUSE1236795, ENSMUSE00001284496 (exons 11-13) and 549 bp of flanking intronic sequence including the splice acceptors and donors and is predicted to cause a change of amino acid sequence after residue 415 and early truncation 44 amino acids later. (J:188991)