Zpld1^em1(IMPC)J

This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CGCTGCTTAGAGGACCATAG, TGGTTCTGTTGATAGGAGCT, AGTGTGCACGTTATTAAGAG and ATAAAAGCACAGTAGAGGGC, which resulted in a 477 bp deletion beginning at Chromosome 16 negative strand position 55,251,842 bp and ending after 55,251,366 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000223414 (exon 4) and 256 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 10 bp deletion (CTATGGTCCT) 26 bp after the large deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 35 and early truncation 25 amino acids later. (J:188991)