Mettl6^em1(IMPC)J

This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGTGGAGTGCTGCCTGGGCA, CTCACTAGTCATGTCCCCAC, AGAGCAACCATTCATAGTAA and GAATTAAAACACAGACCAGT, which resulted in a 390 bp deletion beginning at Chromosome 14 negative strand position 31,483,013 bp and ending after 31,482,624 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000121655 (exon 5) and 248 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 9 bp insertion at the 390 bp deletion site (AGTGAGTGA) and 4 bp deletion (TAGT) 37 bp before the 390 bp deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 177 and early truncation 15 amino acids later. (J:188991)