This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences ACTCAGAAACTCAATAGCAG and GGGCTTGTGAAAAACACTGT, which resulted in a 954 bp deletion beginning at Chromosome 17 negative strand position 25,269,032 bp and ending after 25,268,079 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000207073 (exon 5) and 844 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 74 and early truncation 10 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count