Rex1bd^em1(IMPC)J

This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCAAAAATAGTAGTAGGTCG, GAGAGGGCCCAAATGCATAG, GGGTGTAGCTTTTAGTAGCA and GTTTGTCTCTTTCGAGTCGG, which resulted in a 554 bp deletion beginning at Chromosome 8 negative strand position 70,506,214 bp and ending after 70,505,661 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001291628 (exon 3) and 349 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 52 and early truncation 5 amino acids later. (J:188991)