Embryos were injected with guide RNA targeting exon 2 and Cas9 nuclease. Sequencing of several mice revealed an animal carrying the deletion of a single adenine nucleotide in this signal peptide coding region (CGTCTCCCTTCTCCCACTGATA -> CGTCTCCCTTCTCCCACTG*TA) which created a frameshift and premature stop codon. (J:250608)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count