Mep1b^em1(IMPC)J

This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTGTGTCCCCCCACTGAAAA, ACAGGGTGTTTGCCTCACTG, GAGTATTTAGAGAAGATACC and GCAATCAGTTGTCCAATAAC, which resulted in a 425 bp deletion beginning at Chromosome 18 positive strand position 21,086,087 bp and ending after 21,086,511 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000276519 (exon 7) and 246 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 124 and early truncation 9 amino acids later. (J:188991)