Rbm6^em1(IMPC)J

This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGTTATTTGAAGGCACCAAC, TATGGCTCTTTGTCCACACA, CCAGCTGGCCAAGAATCACA and CTAATTTTTTATTTCCCTAC, which resulted in a 468 bp deletion beginning at Chromosome 9 negative strand position 107,847,543 bp and ending after 107,847,076 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001305293 (exon 5) and 398 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 471 and early truncation 27 amino acids later. (J:188991)