Mfsd4b4^em1(IMPC)J

This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTACAACTCAGCTCTAAATG, CAGGGCCCATCGAGTTCCCA, TTATGACTAGAAGGCCACTG and ACTGTAACAAAACCACAGGA, which resulted in a 388 bp deletion beginning at Chromosome 10 negative strand position 39,895,021 bp and ending after 39,894,634 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001308224 (exon 2) and 219 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 7 and early truncation 21 amino acids later. (J:188991)