This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGCCCTCTTTCACCTGTACA, TGACTATTTTAAGAGTAATG, ATAAACCTACTCATGTCATG and TCTGCTTTAGAATTAAAGGA, which resulted in a 294 bp deletion beginning at Chromosome 17 negative strand position 86,142,597 bp and ending after 86,142,304 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001033695 (exon 2) and 214 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence from the first amino acid and early truncation 4 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count