This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACTTGGCCCATGACTACAAA, GAGAAACTGTATGTGCGGGA, CTGAGTTTAATTCAGCGCTG and CCAGTGTTAGGCAGTGACTG, which resulted in a 1163 bp deletion beginning at Chromosome 1 positive strand position 172,491,340 bp and ending after 172,492,502 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000361352 through ENSMUSE00000366373 (exons 7-9) and 590 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 224 and early truncation 18 amino acids later. (J:188991)