Trf^em1(IMPC)J

This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTCAAACCAGAGGCGTATAG, GCAGGAAGAGGATCATTCCA, GCATCTCTCTAAGCAGCCCA and GATGAATCCGTTCGCCCCAA, which resulted in a 426 bp deletion beginning at Chromosome 9 negative strand position 103,228,289 bp and ending after 103,227,864 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001246941 (exon 2) and 253 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 15 and early truncation 1 amino acids later. (J:188991)