Kcnk16^em1(IMPC)J

This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGGAATATGCTTTATCCCGG, AATGGACCCCAAGCTCAGCA, CTAAGACACTAAGTGGCCAG and CTTAGGCCCTGGCTTCCCAC, which resulted in a 400 bp deletion beginning at Chromosome 14 positive strand position 20,265,075 bp and ending after 20,265,474 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000239215 (exon 2) and 285 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 72 and early truncation 19 amino acids later. (J:188991)