Phldb1^em1(IMPC)J

This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGCCTTAGTGATTTCAAAGG, GGTTCATCCTGAATCCGCCC, CCTACCTCATCCTAGGGCAA and AGCTCCAGTTTTTGGCTCCA, which resulted in a 1782 bp deletion beginning at Chromosome 9 negative strand position 44,716,848 bp and ending after 44,715,067 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000456226 (exon 6) and 430 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 160 and early truncation 13 amino acids later. (J:188991)