Brms1l^em1(IMPC)J

This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences AATATGAAACTGGACATCCA, CCACTGAGATTCAGTGACGA and TGAGGCCAGTGAGGTTTTGG, which resulted in a 562 bp deletion beginning at Chromosome 12 positive strand position 55,841,295 bp and ending after 55,841,856 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000654815 (exon 2) and 471 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a single bp (G) insertion at the deletion site, which will not alter the results of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 47 and early truncation 6 amino acids later. (J:188991)