Srsf9^em1(IMPC)J

This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TCAGTGCTACCCCACAGCCT, GCGAGAGTCACTGAGCAGGG, CATAGGCTGCATTACTTGCA and CTAGCCTTCAAGGAAGTGTG, which resulted in a 285 bp deletion beginning at Chromosome 5 positive strand position 115,330,421 bp and ending after 115,330,705 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001217221 (exon 2) and 124 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 64 and early truncation 33 amino acids later. (J:188991)