Cacna2d4^em1(IMPC)J

This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATCAGATGTCAGATCCTCAA, TCTGACATCTGATCGTGATA, GCAGGGAGACTCTACTTACA and GGGGCTCAAACACAGTCAGA, which resulted in a 173 bp deletion beginning at Chromosome 6 positive strand position 119,238,969 bp and ending after 119,239,141 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000332836 (exon 2) and 91 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 83 and early truncation 8 amino acids later. (J:188991)