This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTACACCTCCCCATTAGAGC, GCCTGGGCTTCTGTGCAACT, AGCTTTTTAGTCATAGCCAA and ATTATCTGAGATTTAATCAA, which resulted in a 449 bp deletion beginning at Chromosome 19 negative strand position 59,042,109 bp and ending after 59,041,661 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000288532 (exon 4) and 354 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 57 and early truncation 2 amino acids later. (J:188991)