Adgrf3^em1(IMPC)J

This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTTAAGAATCTGAATTCTGA, CTTTCTAGAGACCTCCAGCA, GTACAGGGATAACAAAGAAG and ATGTGGGCCTTGGGTCCAGT, which resulted in a 575 bp deletion beginning at Chromosome 5 negative strand position 30,199,382 bp and ending after 30,198,808 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000601748 (exon 8) and 378 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 346 and early truncation 17 amino acids later. (J:188991)