Clrn2^em1(IMPC)J

This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TATGCCTGGATGGTTCAAAA, CAAAAAGGTGTGGTACGGGC, GTGCGGCAATGCGGACTTGG and GGTGCGGCAATGCGGACTTG, which resulted in a 226 bp deletion beginning at Chromosome 5 positive strand position 45,453,820 bp and ending after 45,454,045 bp (GRCm38/mm10). This mutation deletes 226 bp from ENSMUSE00000385096 (exon 1) and is predicted to cause a change of amino acid sequence after residue 3 and early truncation 11 amino acids later. (J:188991)