This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTATTGTTTCAAACTGGTCT, TCCCCTTCCTGCCTTGACAT, TGGGGGAAAAAGACCAGCTA and TTCTGAAATTCAGCATAAAA, which resulted in a 401 bp deletion beginning at Chromosome 4 negative strand position 128,260,766 bp and ending after 128,260,366 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000405638 (exon 1) and additionally inserts 14 bp (TCCCAAGAATGGGG) at the deletion site and is predicted to cause a change of amino acid sequence after residue 2 and early truncation 50 amino acids later. (J:188991)