Efcab7^em1(IMPC)J

This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AACGTAGCCATCAATCAGTG, TCACTAGGTCACTTGGGGCT, TCTAGTAGATTTTTACTGCT and ATCTCAGGTTATCAACAATA, which resulted in a 500 bp deletion beginning at Chromosome 4 positive strand position 99,877,875 bp and ending after 99,878,374 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001051035, ENSMUSE00000631831 (exons 2,3) and 220 bp of flanking intronic sequence including the splice acceptors and donors. In addition there is 7 bp insertion at the deletion site (AAGGGGG) that will not alter the results of the exon deletions. This mutation is predicted to cause a change of amino acid sequence after residue 77 and early truncation 20 amino acids later. (J:188991)