Cpsf7^em1(IMPC)J

This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCACTGATTGAAATATTGCT, GTCTTAATCCCCAAACATAG, GAGACCATCTGTATGAAGGG and GGTTTGGTGGCACAATTAGT, which resulted in a 970 bp deletion beginning at Chromosome 19 positive strand position 10,532,605 bp and ending after 10,533,574 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000224989 and ENSMUSE00000224978 (exons 4 and 5) and 693 bp of flanking intronic sequence including the splice acceptors and donors and is predicted to cause a change of amino acid sequence after residue 91 and early truncation 50 amino acids later. (J:188991)