This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGAGCTACCAAGGTAAACAC, ATTTAGGGTTGTGTACTCAT, GTTACTGGCAATTTGCAGTG and GCCTGTGTTGTTAGTGGCTG, which resulted in a 621 bp deletion beginning at Chromosome 7 negative strand position 57,323,993 bp and ending after 57,323,373 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000490283 (exon 3) and 553 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 67 and early truncation 4 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count