Wnk2^em1Murr

This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AAGCGATAGAGACTTCACCC, TTCACCCTGGAGCCCCTGCG, CAGCCTTGAGTGACAAGACC and CAAGCCTCACCCAGCAGACC, which resulted in 2 small deletions, a 7 bp (GGCTGAG) deletion beginning at Chromosome 13 positive strand position 49,060,745 bp and ending after 49,060,752 bp, followed 27 bp later by a 6 bp deletion (GTGGAG) beginning at Chromosome 13 positive strand position 49,060,753 bp and ending after 49,060,759 bp (GRCm38/mm10). This mutation deletes 13 total bases in ENSMUSE00000642194 (exon 20) and is predicted to cause a change of amino acid sequence after residue 1538 and early truncation 9 amino acids later. (J:188991)