Ndufa9^em1(IMPC)J

This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGCTCTTTAGAACTTGACCA, GGACTCACGGGTGCTCCACA, GTATTGACAATGAGTAGGCC and GCCTTAGGAAAAATTACTTT, which resulted in a 416 bp deletion beginning at Chromosome 6 positive strand position 126,840,391 bp and ending after 126,840,806 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000240808 (exon 5) and 274 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 137 and early truncation 6 amino acids later. (J:188991)