Acox3^em1(IMPC)J

This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATGTCCAGACAAGCTGACAG, TTTTGTTAGGACTCTTACCA, GCTTAAGCCGCTGTTCCCAG and GTCACACCCTGAGAGACCCG, which resulted in a 687 bp deletion beginning at Chromosome 5 positive strand position 35,594,039 bp and ending after 35,594,725 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000185499 (exon 8) and 598 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 231 and early truncation 21 amino acids later. (J:188991)