Dhtkd1^em1(IMPC)J

This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences TAGTGGCGAGCGATCTTTGC, GTTTGTAATGGAGCTCACGG and CCGCCCAGAAGGGAAGTCGA, which resulted in a 597 bp deletion beginning at Chromosome 2 negative strand position 5,931,083 bp ACGGTGGAAGCAGCAGAGGC, and ending after TTCCTGCAAAGATCGCTCGC at 5,930,487 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000605446 (exon 3) and 385 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 105 and early truncation 1 amino acid later. (J:188991)