Fnbp1^em1(IMPC)J

This allele from project Fnbp1-8741J-1502M was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences GGTGTCCTCCTCCAAAGACA, TCTGGCCTGAGAATAAACAG and TTACAACCCAAACCCGGCCA, which resulted in a 397 bp deletion beginning at Chromosome 2 negative strand position 31,096,377 bp, CTGAGAATAAACAGAGGCAG, and ending after CAAAGACAAGGATGTTCTAC at 31,095,981 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001281997 (exon 4) and 249 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 67 and early truncation 10 amino acids later. (J:188991)