Two sgRNAs (targeting CTGTGGAAACAGCCATAAG' and GCAAGAGCGCCAGTTTTTCA) flanking the region were used with the CRISPR/Cas9 system to create deletions. The deletion in this allele is 359 bp of endogenous sequence but an additional 56 bp were inserted, creating a net deletion of 303 bp. (J:241393)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count