This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATATGATATGTTTCCCTCAC, AACACATATTGCTTCCTGTG, CACCTCGTAGATAAATGCTG, and AGGAAGGTGAGACCAGTCAA, which resulted in a 447 bp deletion beginning at Chromosome 2 negative strand position 77,450,461 bp, ACCTCGTAGATAAATGCTGG, and ending after ATATGATATGTTTCCCTCAC at 77,450,015 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000326653 (exon 4) and 284 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is an 8 bp intronic deletion (GTTGACTG) 108 bp before the 447 bp deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 67 and early truncation 5 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count