This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCTCCTGGCTCTCACAGCAA, TTACCATAACAAAGGGAAGG, GCAGTTCTCACCTAGACTGA, and TGTATGGGTGAGATAATTAT, which resulted in a 423 bp deletion beginning at Chromosome 18 negative strand position 84,553,166 bp, GTGAGATAATTATGGGAATA, and ending after TGCGTATCCTCCTTCCCTTT at 84,552,744 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001220921 (exon 3) and 308 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 1554 and early truncation 3 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count