Zfp706^em1(IMPC)J

This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTGACTGTAGATAATATCCT, ACTGCTAGCTGGGAAAATGT, CCAGACAGTTCAAATATCAT and TATACTCATTTGTCATCTAG, which resulted in a 629 bp deletion beginning at Chromosome 15 positive strand position 37,003,474 bp, CTACATTTTCCCAGCTAGCA, and ending after AGTTCAAATATCATTGGTAA at 37,004,102 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000514075 (exon 2) and 492 bp of flanking intronic sequence including the start site and is predicted to cause a null allele. (J:188991)